Comparison of Western Blot and ELISA

Research will be limited to:
- Method: Western blot
- Method: ELISA
- Metric: Sensitivity
- Metric: Throughput
- Metric: Quantification Accuracy
- Resource: Antibody Requirements

Strategy: I will conduct a comparative analysis of Western Blot (WB) and Enzyme-Linked Immunosorbent Assay (ELISA) by targeting peer-reviewed literature that specifically benchmarks these two methods against the four requested metrics: sensitivity (LOD/LOQ), throughput (samples per run), quantification accuracy (dynamic range/linearity), and antibody requirements (monoclonal vs. polyclonal/volume). I will prioritize systematic reviews and technical validation studies that provide quantitative data for these comparisons.
Queries:
- Western blot vs ELISA sensitivity limit of detection comparison
- ELISA vs Western blot throughput and quantification accuracy benchmarking
- antibody requirements Western blot vs ELISA volume specificity
- quantitative Western blot vs ELISA dynamic range linearity comparison
- comparison of protein quantification methods sensitivity throughput accuracy

Executing 5 concurrent searches:
- Western blot vs ELISA sensitivity limit of detection comparison
- ELISA vs Western blot throughput and quantification accuracy benchmarking
- antibody requirements Western blot vs ELISA volume specificity
- quantitative Western blot vs ELISA dynamic range linearity comparison
- comparison of protein quantification methods sensitivity throughput accuracy

Found 6 papers. Key excerpts:

Comparative performance of ELISA and dot blot assay for TSH-receptor antibody detection in Graves’ disease — Zulkarnain Zulkarnain et al., 2022

Background

           Graves’ disease (GD) is an autoimmune disease, and it accounts for major cases of hyperthyroidism. Antibody against thyroid-stimulating hormone receptor/TSHR (TRAb) is responsible for hyperthyroidism and is considered as a diagnostic marker for GD. Therefore, we developed a recombinant protein of human TSHR-169 (hTSHR-169), which was specifically recognized TRAb in the serum of GD patients and then compare the diagnostic performance between ELISA and dot blot of TRAb tests for their ability to diagnose GD.

Methods

           20 GD patients and 20 healthy individuals from the Indonesian population were enrolled. TRAb concentration and density were quantified. Comparative analysis was performed using receiver-operating curve (ROC) analysis.

Results

           For dot blot assay, the minimum concentration to detect TRAb requiring 100 ng of antigen with antiserum diluted at 1:60. For diagnosing GD, the ELISA yielded a higher AUC compared with the dot blot assay (0.95 and 0.85, respectively). Using the recommended cutoff values, the efficiency of both assays was examined by comparing the specificity and sensitivity of the assays to the clinical diagnosis. The ELISA showed 80% and 95%, while the dot blot assay showed 70% and 95% sensitivity and specificity, respectively.

Conclusion

           Although the dot blot assay exhibited lower performance than the ELISA method, the dot blot assay is a simple and rapid diagnostic assay that is suitable for diagnosing GD in rural areas, in which healthcare facilities sometimes are not accessible.

1 INTRODUCTION

     Graves’ disease (GD) is a chronic autoimmune disorder of the thyroid gland, affecting nearly 0.5% of the general population, with a

higher incidence among females relative to males.1, 2 Clinically, GD is characterized by the suppression of TSH levels, overstimulation of thyroid hormones, and the production of antithyroid antibodies.1, 3 It is now well established that thyroid-stimulating hormone receptor autoantibody (TRAb) is the serological hallmark of GD,4 which is usually helpful in differentiating GD from other causes of hyperthyroidism. Additionally, the role of TRAb is not only in confirming GD diagnosis but also potential in predicting the clinical course of GD, relapse risk, and treatment responses.1, 3, 5

     Although TRAb is easy to perform, the measurement of TRAb levels is not routinely employed in all suspected GD patients. Hence, studies examining TRAb levels during the initial diagnosis of GD are relatively scarce. The diagnostic performance of TRAb for GD differs according to the TRAb detection method. However, the sensitivity and specificity of TRAb assay are relatively comparable, ranging from 79.5 to 94.4% and 87.5 to 97.9%, respectively.1, 4 Therefore, in this study, we developed a recombinant protein of hTSHR-169, which was specifically recognized TRAb from the serum of GD patients, in order to generate lateral flow-based immunoassay for diagnosing GD case. However, this particular recombinant’s utility for GD diagnosis has not been assessed. Herein, we compared ELISA and dot blot of TSH-receptor antibody tests for their ability to diagnose GD.

2 METHODS

        2.1 Molecular cloning and development of recombinant hTSHR-169 protein

        Construct of hTSHR-169 cDNA was synthetically made through GBlock gene fragments (Ref. No. 100031579, Integrated DNA Technologies) consisting of 417 oligonucleotide bases that was optimized according to our previous work.6 The construct was designed by adding BamH1 and Xho1 restriction sites at the N-terminus and C

-terminus, respectively. The construct was then subcloned into a pET28a vector (Novagen). Briefly, pET28a (+) vector and hTSHR-169 cDNA fragment were digested with the same restriction enzyme (BamHI and XhoI, New England Biolabs) at 37°C for 1 h. The digested pET28a (+) vector backbone and the fragment cut from hTSHR-169 cDNA were purified by Gel/PCR DNA Fragments Extraction Kit (Geneaid). The hTSHR-169 fragment and pET28a (+) vector backbone were ligated by T4 DNA ligase enzyme (New England Biolabs) at 16°C for 75 min. The ratio of vector ends and inserts ends is 1:5. The recombinant plasmid map is illustrated in Figure 1A.

                 FIGURE 1Open in figure viewerPowerPoint

                 Cloning of hTSHR-169 in pET28a (+) vector. (A) Schematic representation of the pET28a (+) expression vector-harboring gene encoding hTSHR-169 protein. (B) PCR product of recombinant clone (amplicon size 689 bp); M: DNA Marker; NC, negative control; lane 1–5: recombinant clone, replication 1–5. (C) Restriction enzyme analysis of recombinant pET28a-hTSHR-169 expression vector. M: DNA Marker; lane 1: undigested pET28a (+) vector; lane 2: digested pET28a (+) vector; lane 3: undigested recombinant pET28a (+) vector; lane 4: digested recombinant pET28a (+) vector with

Comparison Of Four Anti-Avian IgY Secondary Antibodies Used In Western Blot And Dot-Blot ELISA To Detect Avian Bornavirus Antibodies In Four Different Bird Species — Paulina Escandon et al., 2022

IntroductionIn 2008, avian bornavirus (ABV) was discovered to be the causative agent of Parrot bornavirus syndrome (PaBVs), formerly known as macaw wasting disease, proventricular dilatation disease or PDD, enteric ganglioneuritis and encephalitis, and avian ganglioneuritis.1Kistler AL, Gancz A, Clubb S, et al. Recovery of divergent avian bornaviruses from cases of proventricular dialatation disease: identification of a candidate etiologic agent. Virol J. 2008;5:88–102. doi:10.1186/1743-422X-5-8818671869 [Crossref], [Web of Science ®], [Google Scholar]–3Gray P, Hoppes S, Suchodolski P, et al. Use of avian bornavirus isolated to induce proventicular dilatation disease in conures. Emerg Infec Dis. 2010;16:473–479. doi:10.3201/eid1603.09125720202423 [Crossref], [Web of Science ®], [Google Scholar] Since then, multiple ABV genotypes have been recognized in over 80 different species such as psittaciformes, passeriformes, and waterfowls.4Kuhn JH, Dürrwald R, Bào Y, et al. Taxonomic reorganization of the family Bornaviridae. Arch Virol. 2015;160:621–632. doi:10.1007/s00705-014-2276-z25449305 [Crossref], [Web of Science ®], [Google Scholar] Diagnosis of PaBVs includes clinical signs and radiological changes, detection of viral antigen, viral RNA or ABV antibodies, gross pathology, and histopatholgy.5Raghav R, Taylor M, DeLay J, et al. Avian bornavirus is present in many tissues of psittacine birds with histopathologic evidence of proventicular dilatation disease. J Vet Diagn Invest. 2010;22:495–508. doi:10.1177/10406387100220040220622218 [Crossref], [Web of Science ®], [Google Scholar]–8

Piepenbring AK, Enderlein D, Herzog S, et al. Pathogenesis of avian bornavirus in experimentally infected Cockatiels. Emerg Infect Dis. 2012;18:234–241. doi:10.3201/eid1802.11152522304809 [Crossref], [Web of Science ®], [Google Scholar] Sampling for histopathology and tissue immunoassays, especially of nervous tissues, is not practical in living birds, thus these tests are more commonly used in post-mortem diagnosis. Reverse transcriptase polymerase chain reaction (RT-PCR) can utilize less invasive samples such as feather follicles, feces/urine, and cloacal swabs,5Raghav R, Taylor M, DeLay J, et al. Avian bornavirus is present in many tissues of psittacine birds with histopathologic evidence of proventicular dilatation disease. J Vet Diagn Invest. 2010;22:495–508. doi:10.1177/10406387100220040220622218 [Crossref], [Web of Science ®], [Google Scholar],7Leal de Araujo J, Rech RR, Heatley JJ, et al. From nerves to brain to gastrointestinal tract: a time-based study of parrot bornavirus 2 (PaBV-2) pathogenesis in cockatiels (Nymphicus hollandicus). PLoS ONE. 2017;12:e0187797.29121071 [Crossref], [Web of Science ®], [Google Scholar],9de Kloet AH, Kerski A, de Kloet SR. Diagnosis of avian bornavirus infection in psittaciformes by serum antibody detection and reverse transcription polymerase chain reaction assay using feather calami. J Vet Diagn Invest. 2011;23:421–429. doi:10.1177/104063871140340621908270 [Crossref], [Web of Science ®], [Google Scholar]–13Heatley JJ, Villalobos AR. Avian bornavirus in the urine of infected birds. Vet Med Res Rep. 2012;3:19–23. [Crossref], [Google Scholar] however sensitivity will vary due to intermittent viral shedding.13Heatley JJ, Villalobos AR.

Avian bornavirus in the urine of infected birds. Vet Med Res Rep. 2012;3:19–23. [Crossref], [Google Scholar]–15Rubbenstroth D, Schmidt V, Rinder M, et al. Phylogenetic analysis supports horizontal transmission as a driving force of the spread of avian bornavirus. PLoS ONE. 2016;11:e0160936. doi:10.1371/journal.pone.016093627537693 [Crossref], [Web of Science ®], [Google Scholar]Immunologic testing comparing ABV specific antigens found that the viral nucleoprotein is immunodominant and hence the best antigen to use in a microtiter plate ELISA and in fluorescent antibody assays.9de Kloet AH, Kerski A, de Kloet SR. Diagnosis of avian bornavirus infection in psittaciformes by serum antibody detection and reverse transcription polymerase chain reaction assay using feather calami. J Vet Diagn Invest. 2011;23:421–429. doi:10.1177/104063871140340621908270 [Crossref], [Web of Science ®], [Google Scholar],16Zimmermann V, Rinder M, Kaspers B, et al. Impact of antigenic diversity on laboratory diagnosis of avian bornavirus infections in birds. J Vet Diagn Invest. 2014;26:769–777. doi:10.1177/104063871454725825135010 [Crossref], [Web of Science ®], [Google Scholar] A mixed anti-avian species IgY secondary antibody is often used in ABV serologic tests.8Piepenbring AK, Enderlein D, Herzog S, et al. Pathogenesis of avian bornavirus in experimentally infected Cockatiels. Emerg Infect Dis. 2012;18:234–241. doi:10.3201/eid1802.11152522304809 [Crossref], [Web of Science ®], [Google Scholar],9de Kloet AH, Kerski A, de Kloet SR. Diagnosis of avian bornavirus infection in psittaciformes by serum antibody detection and reverse transcription polymerase chain reaction assay using feather calami. J Vet Diagn Invest. 2011;23:421

Prevalence of Toxoplasma gondii Measured by Western Blot, ELISA and DNA Analysis, by PCR, in Cats of Western Mexico. — María de la Luz Galván-Ramírez et al., 2022

Toxoplasma gondii is an intracellular parasite that presents a significant threat to public health. Congenital toxoplasmosis occurs when the mother is first infected with Toxoplasma during pregnancy; the parasite can infect the foetus, causing death or severe neurological impairment, inflammation, and retinochoroiditis [ 1 , 2 ]. Immunocompromised patients are associated with severe damage to the central nervous system, lethal encephalitis, and myocarditis [ 1 , 2 ]. Infection can be acquired by various mechanisms: vertical transmission, from mother to child; orally, via cysts present in raw or undercooked meat [ 1 ]; or oocysts present in water and/or fruit and vegetables watered with sewage water and eaten without washing [ 2 ]. Other mechanisms include infected organ transplants, blood transfusions, and direct contamination when working in laboratories with hand wounds when the parasite or contaminated raw meat is handled.
The reproductive sexual cycle of Toxoplasma takes place only in the definitive hosts (domestic and wild cats). Gastric enzymes destroy the cyst wall in the small intestine after ingestion of the cysts present in the host tissues. Approximately 15 to 20 days after infection, cats shed more than 100 million oocysts in their faeces [ 3 ]. Moreover, oocysts are highly resistant to adverse environmental conditions, increasing the risk of infection in humans and animals [ 4 , 5 ]. Toxoplasma infection in cats is, in most cases, asymptomatic, complicating the diagnosis of the disease by veterinarians.
The epidemiology in humans in Mexico in a study of the meta-analysis of 41 publications and 70,123 individuals showed the average mean weighted prevalence was 27.97%. The prevalence was higher in women with miscarriages (36.03%), immunocompromised patients (28.54%), mentally ill patients (38.52%), and other risk groups (35.13%). However, Toxoplasma infection among the Mexican population showed a downward trend of 0.1%/year over a period of sixty years, which represents a 5.8% reduction in prevalence [ 6 ].
Epidemiological reports of Latin American countries have shown a high prevalence of Toxoplasma infection in cats (41.9%) [ 7 , 8 , 9 ]. Similarly, in Mexico, epidemiological surveys conducted in cats in the last ten years have indicated an average prevalence of 40.8%.

States such as Colima, Durango, and Mexico City have reported prevalence rates of 28.8%, 21%, and 21.8%, respectively [ 10 , 11 , 12 ]. In contrast, in the Yucatan, a high prevalence of 91.8% of cats has been reported [ 7 ]. In Jalisco, a study in 1999 identified a prevalence of 70.8% for IgG and 8.3% for IgM anti- Toxoplasma antibodies [ 13 ]. In the last ten years, Mexican federal and local regulations, promoted by the Mexican Association of Veterinarians Specializing in Small Species (AMMVEPE), have increased the number of shelters, providing further support to stray cats and facilitating adoption.
In the metropolitan area of Guadalajara, seroprevalence studies associated with Toxoplasma gondii infection in cats have not been performed for more than 20 years. Therefore, the seroprevalence of 70% reported by Galvan et al. in 1999 was used as the statistical data as a reference [ 13 ]. There is no precise census of the cat population; however, according to the Mexican Association of Veterinarians Specializing in Small Species (AMMVEPE), the region contains 23 million dogs and cats, of which 6,900,000 are pets, while the rest live on the street. Of these 6 million, 2,070,000 were estimated to be cats. Specifically, in the Guadalajara metropolitan area, there were 73,000 cats.
There is no existing cat census in the metropolitan region of Guadalajara; however, in 2016, it was estimated that the region homed 100,000 cats, of which 25% were strays [ 14 ]. The objective of this study was thus to determine the prevalence of T. gondii antibodies and DNA in cats and to describe the possible associated risk factors.
Of the 44 cats, 19 (6.3%) were shelter cats and 25 (8.4%) were home cats; the statistical analysis between both categories showed no significant statistical difference. Of the households where the sampling was carried out, 15% of them had more than four cats, of which at least two were positive.
The average age of the cats included in this study was 20.7 ± 27.8 months, with a significant standard deviation due to the age dispersion, which varied from 1 month to 156 months (13 years of age for

the oldest cat). The positivity of anti- Toxoplasma antibodies was analysed through Western blot in the two age groups: <one year, 7.8% positive; ≥one year, 24%. A statistically significant difference ( p < 0.001) was found between the two age groups.
The prevalence of anti- Toxoplasma antibodies in cats was further analysed by sex; the female group showed a slightly higher positivity rate than males (16.3 vs. 13.6%, respectively). Analysis between groups was performed using the chi-square test, or Student’s t-test for independent samples and did not reveal any statistically significant differences ( Table 1 ).
The highest prevalence of anti- Toxoplasma antibodies was observed in the municipalities of Tlajomulco de Zuñiga 20%, Zapopan 19.6%, and 14.3% Guadalajara. Tonalá and San Pedro Tlaquepaque had lower seroprevalence rates of 7.7 and 5%, respectively ( Table 1 ). According to municipalities in the metropolitan zone of Guadalajara, the geographic distribution of positive cats was higher in cities with a high population density per km 2 , as shown in Figure 1 and Table 1 .
Positivity to anti- T. gondii IgG antibodies was analysed in the presence or absence of the following variables: complete vaccination, consumed raw meat, other animals in the same habitat, current deworming, and body condition. However, we did not find any statistically significant differences in any of the variables Table 2 .
Cats positive to PCR, western blot and ELISA.
The cat 21/10-222 was male and less than 2 years old. It was identified in the municipality of Guadalajara but was originally adopted from the state of Sonora, Mexico. The cat was vaccinated with the triple feline vaccine and had been dewormed within the last 6 months. The cat’s staple food was kibble in combination with raw meat on a few occasions. The cat did not present hunting habits according to the owners.
On the other hand, cat 24/10-223 was male and less than 4 years old and was identified in the municipality of Guadalajara. The owners stated that the cat was not vaccinated or dewormed. The owners also confirmed that the cat had hunting habits and had captured insects and small birds on several

Comparisons of ELISA and Western blot assays for detection of autophagy flux — Sung-Hee Oh et al., 2017

Specifications Table Table Subject area Biochemistry More specific subject area Assay development and method Type of data Tables How data was acquired enzyme-linked immunosorbent assay (ELISA), Western blotting Data format Descriptive data: mean±SD, analyzed Experimental factors C2C12 myotubes and male wild-type C57BL/6 mouse skeletal muscle Experimental features in vitro and in vivo autophagy/mitophagy flux were measured using two immunodetection techniques Data source location Hwaseong, South Korea Data accessibility Data are available with this article
Value of the data • The presented data indicated that the ELISA had smaller data distribution and was more repeatable to measure autophagy/mitophagy flux, compared with Western blot data. • These data could be helpful for many autophagy researchers to obtain more accurate and reproducible data using this ELISA technique. • These data could also be beneficial for researchers in other areas to adapt the ELISA-based assay strategy from the Western blot.

Combined use of ELISA and Western blot with recombinant N protein is a powerful tool for the immunodiagnosis of avian infectious bronchitis — Paula Fonseca Finger et al., 2018

Background Avian infectious bronchitis (IB) is caused by a virus in the Coronaviridae family, genera Gammacoronavirus. It is a highly contagious disease with a short incubation period [ 1 ] . The Avian coronavirus was previously classified, and is most commonly referred to, as avian infectious bronchitis virus (IBV). The IBV is responsible for respiratory disease, which manifests in clinical symptoms such as sneezing and tracheal-bronchial rales that can lead to the development of more severe symptoms [ 2 , 3 ]. Infected birds exhibit reduced performance, consequently leading to a reduction in weight gain and deterioration in egg quality and quantity. Secondary bacterial infections will also contribute to economic losses. Carcass condemnation due to the development of airsacculitis [ 4 , 5 ] negatively impacts commercial sales of bird meat and eggs. Brazil was once the world’s largest exporter of poultry and currently the world’s third largest producer of bird meat [ 6 ]. The consequences of IBV are a significant threat to Brazil’s poultry industry. The IBV genome consists of a non-segmented positive-sense single-stranded RNA that is approximately 27.6 kb in length. It encodes non-structural (accessory proteins) and four structural proteins: the nucleocapsid protein (N), the spike protein (S), the envelope protein (E), and the matrix protein (M). The nucleocapsid protein, or N protein, consists of 409 amino acids. It has a molecular mass of approximately 50 kDa and directly binds with the viral genome to form the virion nucleocapsid [ 6 , 7 ]. Its structure is highly conserved, with different strains of IBV sharing a high degree of identity (94–99%) [ 8 ]. The N protein is also known for its immunogenicity, inducing specific antibody and cytotoxic T-cells mediated responses [ 9 , 10 ]. There is significant interest in the use of the IBV N protein as an important target for diagnosis since it possesses the antigenic characteristics required for the development of serological assays that can be applied to detect or quantify antibodies against the IBV [ 11 ]. The laboratory diagnosis of IB is dependent on direct and indirect techniques. The direct techniques are employed for viral isolation and genomic or phenotypic identification of the virus, while the indirect

methods are used to detect specific antibodies [ 12 ]. In addition to being applied for serodiagnosis, serological techniques can also be employed to evaluate the immune responses stimulated by vaccines. Commercial ELISA kits are typically used to indirectly diagnose IBV. These kits, however, are expensive when large number of samples require screening and they are not acessible for applications with the scale of the Brazilian poultry industry [ 13 , 14 , 15 ]. ELISA techniques currently available are designed to detect polyclonal antibodies that target the whole virion. The use of nucleoprotein as the antigen for diagnosis and evaluation of vaccine immune responses is an interesting target to explore since this protein plays a important role in IBV virus replication and the induction of a specific immune response in infected birds [ 16 , 17 ]. The use of recombinant antigens in the design of a specific diagnostic technique facilitates the development of highly sensitive and specific assays that display a high antigen concentration and, thereby, reduce or eliminate background reactions. The use of recombinant antigens also represents a viable method of reducing immunoassay development costs. Easy production of antigens in expression systems leads to simple and efficient antigen development which can reduce the production costs associated with diagnosis [ 18 ]. The aim of the current study was to evaluate the combined use of an ELISA and Western blot (WB) to detect antibodies against the nucleocapsid protein of IBV.
Methods Virus strain and viral RNA extraction A previously characterized Brazilian viral sample of IBV Strain Massachusetts 41 (M41- CNPSA – EMBRAPA – Concórdia, SC, Brazil) was propagated after 9 days of incubation in the chorioallantoic cavity of specific pathogen free (SPF) embryonated chicken eggs. The allantoic fluid was then collected and stored at − 70 °C. Viral RNA extraction was carried out with TRIzol® LS reagent (Invitrogen™, EUA), according to the manufacturer’s instructions. N protein coding sequence amplification and cloning Extracted RNA from IBV strain M41 was used for cDNA synthesis with random oligonucleotides. Reverse transcription (RT) was carried out using SuperScript® One-Step RT-PCR System (Invitrogen, USA). The resulting cDNA samples were used to for PCR amplification of the whole orf of the N protein gene. Primers based on the

IBV M41 N protein gene sequence available at GenBank (accession number M28566) were designed to align between 102 and 120 and 1312–1331 bp of the gene and include cleavage sites for restriction enzymes. There was a restriction site for Xho I in the forward primer (5′ – CCG CTCGAG ATGGCAAGCGGTAAGGCAA – 3′) and a restriction site for Kpn I in the reverse primer (5′ – GG GGTACC TCAAAGTTCATTCTCTCCTA – 3′). The PCR reaction was performed with approximately 25 ng of the extracted cDNA, 3.5 mM MgCl, 0.2 mM dNTPs, 2 units of Taq DNA polymerase, 1X reaction buffer, 1 pmol of each primer, and 5 M N,N,N-trimethylglycine (betaine) under the following conditions: 1 cycle of 95 °C for 7 min, 1 cycle of 70 °C for 1 min, then 45 cycles of 94 °C for 1 min, 50 °C for 1 min, and 72 °C for 4 min, and a final extension of 72 °C for 10 min. The PCR amplification product was confirmed on a 1% agarose gel and purified using GFX PCR DNA and Gel Band Purification kit (GE Healthcare, Chicago, USA), according to the manufacturer’s instructions. Recombinant N protein (rN) expression The PCR product was cloned into pAE vectors by a T4 DNA ligase (Invitrogen) binding reaction after cleavage with restriction enzymes Kpn I and Xho I. The constructed recombinant pAE/ n expression vector was used to transform E. coli BL21(DE3) Star competent cells (Invitrogen). The resulting recombinant clones were cultivated in 10 mL of LB broth medium with 100 μg/mL of ampicillin (37 °C, 16 h, 250 rpm). The whole culture volume was transferred to flasks containing 200 mL of LB and incubated at 37 °C with agitation (

Biochemical analysis challenging Western blot analysis as validation step for antibodies intended for ELISA and Immunohistochemistry use — Yunyun Zhang et al., 2022

IntroductionBoth the conformational structure (shape) and the primary structure (sequence) of an epitope in an antigen are essential components of antigen-antibody interaction (AAI). An epitope is generally categorized as conformational or linear epitope in literature (1). The term “linear epitope” refers to those epitopes relying primarily on sequence, rather than shape, for AAI. Conversely, Conformational epitope refers to those epitopes recognized by the antibody primarily through shape rather than sequence. Not surprisingly, conformational epitope is also called discontinuous epitope while linear epitope is called continuous epitope.A common assumption behind these definitions is that for continuous epitopes, the contributions from their shapes are minimal to AAI. Yet, there is limited attempt to validate this assumption. In other word, does the shape of a continuous epitope make any contribution to the overall AAI?AAI is the pillar of immunodetection techniques including Enzyme linked Immunosorbent Assay (ELISA), Western blot analysis (WB), Reverse phase protein array and Immunohistochemistry (IHC). For WB, the antigen targets are usually fully denatured with all the conformational structure of the epitopes destroyed by the combined usage of heat, Sodium Dodecyl Sulfate (SDS), and reducing reagent [Dithiothreitol (DTT) or β-mercaptoethanol]. The term “linear epitope” fits its definition well in this case, as the sequence is the sole determinant of AAI at the denatured state.On the other hand, the shape of the epitope is well preserved at native states. For antigens studied in IHC, they are extensively crosslinked by a fixative agent, most often by Formalin. While they are assumed at denatured state by many experts(2), there is little evidence that the conformation or shape of the epitope is affected by Formalin fixation (FF).Recently, a high throughput immunoassay, Quantitative Dot Blot (QDB), was introduced to measure protein levels absolutely and quantitatively(3–7). This method is able to measure overall AAI at any states of the antigen including fully denatured, native and formalin fixed (FF) states. It thus can allow us to compare the performance of an antibody at all these three states objectively and quantitatively. Here we

screened all the available antibodies in the laboratory with the sole requirement that these antibodies must be specific in WB analysis. We were able to identify six antibodies against FGFR2, CDK2, CDK4, PYGL, ATP5A and CAMKII proteins respectively. Their source information RRIDs were provided in Materials and Methods section(2). Among these six antibodies, four (CDK4, PYGL, ATP5A and CAMKII) are suggested to use for both Western blot analysis and immunohistochemistry (IHC) while the other two (FGFR2 and CDK2) are suggested for Western blot analysis only.
Results and discussionWe defined lysates at the fully denatured form when they were heated in neutral lysis buffer at 85°C for 5mins in the presence of 50 mM DTT and 1%SDS. Those protein lysates in neutral lysis buffer without any treatment were defined as at native state. The FF state was defined as total protein lysates extracted from tissues pre-fixed in formalin solution for 16 hours without any other treatment. The mouse liver lysate was prepared accordingly, and was diluted from 0 to 1 μg/unit for QDB analysis. As shown in Fig. 1, all six antibodies recognized only one band of expected size in WB, confirming their specificity at denatured state. Unexpectedly, when measured the total AAIs with QDB method, we found all AAIs at native state were significantly higher than those at denatured state, ranging from 2.0 ∼ 8.8 over those at denatured state. Likewise, AAIs at FF state were also significantly higher than those at denatured states, ranging from 1.2 ∼ 45.4 folds over those at denatured state.Download figureOpen in new tabFig. 1. Comparison of performance of antibodies interacting with antigens at native, Formalin Fixed (FF) and denatured states in mouse liver. Whole tissue lysates from 6 mouse livers were extracted using lysis buffer containing Triton-X 100 buffer, and used directly as native state, or treated with 1% SDS, and 50 mM DTT for 5 mins at 85°C as denatured state. In a parallel experiment, the mouse liver tissues were fixed in 10% Formalin Solution for 16 hours and tissue lysates prepared as FF state. The total Antigen

-antibody interactions (AAIs) at native, denatured and FF states for each antibody were plotted as in Fig. 1A to 1F respectively. The results from Western blot analysis of each antibody using denatured mouse liver lysates were inserted in Fig. 1A to 1F correspondingly.We also prepared cellular lysates using HEK293 cells at all three states as described above, and diluted these lysates from 0 to 2 μg/unit. Again, all the antibodies recognized only one band of expected size in WB. We also observed that AAIs at native state were significantly higher, ranging from 1.3 ∼ 10.2, than those at denatured state. On the other hand, only three of the antibodies (FGFR2, ATP5A and CAMKII) recognized FF antigens significantly better than those of denatured ones. The other three antibodies recognized FF antigens either at similar level (CDK2 and PYGL) or worse (CDK4) than those of denatured state.Even more surprisingly, the same CDK4 antibody was able to recognize FF antigen significantly better than denatured antigen in mouse liver, but not in HEK293 cells. This observation suggested that AAI interactions of CDK4 in mouse liver and human cell line may be different. Currently, we do not have a good explanation of this discrepancy (Fig. 1c and Fig. 2c). One putative explanation was that there might exist different cellular signaling pathway between mouse liver and HEK293 cell lines, where a unique factor in HEK293 cells might be “stapled” with CDK4 to block the access of anti-CDK4 antibody at FF state. Nonetheless, the difference between AAIs of native and FF states demonstrated that the FF state was indeed different from both native and denatured states.Download figureOpen in new tabFig. 2. Comparison of performance of antibodies interacting with antigens at native, FF and denatured states in HEK293 cells. Whole cell lysates from HEK293 cells were extracted using lysis containing Triton-X 100 buffer, and used directly as native state, or treated with 1% SDS, and 50 mM DTT for 5 mins at 85°C as denatured state. In a parallel experiment, HEK293 cells were fixed in 10% Formalin Solution for 1 hour