Optimized PCR for GC-rich Templates

Research will be limited to:
- Template: GC-rich DNA
- Method: Polymerase Chain Reaction (PCR)
- Reagents: DMSO, Betaine
- Troubleshooting: Smear bands

Strategy: The objective is to identify optimized PCR protocols specifically for GC-rich templates using DMSO and Betaine, while addressing the specific failure mode of 'smeared bands'. I will search for comparative studies on additive concentrations, synergistic effects of DMSO/Betaine, and cycling parameter adjustments (e.g., touchdown PCR, denaturation temperatures) that specifically mitigate non-specific amplification and smearing in high-GC contexts.
Queries:
- PCR optimization GC-rich template DMSO betaine synergistic effect
- troubleshooting smeared bands PCR high GC content additives
- optimal concentration DMSO betaine PCR GC-rich DNA smearing
- touchdown PCR protocol GC-rich templates DMSO betaine
- polymerase selection for GC-rich DNA PCR smearing prevention

Executing 5 concurrent searches:
- PCR optimization GC-rich template DMSO betaine synergistic effect
- troubleshooting smeared bands PCR high GC content additives
- optimal concentration DMSO betaine PCR GC-rich DNA smearing
- touchdown PCR protocol GC-rich templates DMSO betaine
- polymerase selection for GC-rich DNA PCR smearing prevention

Found 9 papers. Key excerpts:

Enhancement Effects and Mechanism Studies of Two Bismuth-Based Materials Assisted by DMSO and Glycerol in GC-Rich PCR. — Zhu Yang et al., 2023

PCR is widely used in DNA and RNA molecular analysis and diagnosis. However, amplifying the high GC content of DNA fragments is more difficult than for non-high GC content target fragments [ 1 ]. GC-rich sequences in the human genome are common and include important regulatory domains such as promoters, boosters, and control elements [ 2 , 3 ]. PCR amplification of GC-rich DNA is often problematic because the secondary structure of DNA is stable and not easy to melt. These secondary structures cause DNA polymerases to stop, leading to incomplete and non-specific amplification [ 4 ]. Several methods have been developed to amplify these problematic GC-rich DNA fragments. The reaction mixture, which includes organic molecules such as dimethyl methylene (DMSO), glycerol, polyethylene glycol, methylene-amide, beetroot, 7-deaza GTP, and dUTP, has been shown to improve the amplification of GC-rich DNA sequences [ 5 , 6 , 7 , 8 , 9 ]. In addition, different PCR strategies have been improved, such as thermal start PCR by gradually decreasing PCR and thermal starting methods combined with touch to increase PCR production [ 10 ]. However, these optimization effects are confined, limiting their wide application. In the past two decades, with the wide application of nanomaterials, many nanomaterials such as gold nanoparticles (Au NPs), graphene, carbon nanotubes, titanium dioxide and quantum dots have been used for PCR amplification [ 11 ]. They can not only effectively enhance amplification specificity, but also increase the yield. However, to successfully synthesize nanomaterials with excellent performance, it is often extremely complex, requiring multiple surface modifications and adjustment of synthesis parameters. Therefore, finding new materials with comprehensive optimization effects and simple preparation methods at low prices would be highly desirable.
Among the existing materials, bismuth-based materials have broad prospects for biomedical applications [ 12 , 13 , 14 ]. First of all, the storage of bismuth in China accounts for its first place in the world, which is a cheap metal; secondly, the bismuth complex shows good photoelectric signal conversion performance and stability; in addition, the good photothermal conversion efficiency of bismuth-based materials makes it suitable for tumor treatment [ 15 , 16 ]; finally, bismuth, which has a good antibacterial effect, has been widely used in the treatment of Helicobacter pylori and has also been used to treat gastric

ulcers and to prevent and treat of diarrhea [ 17 , 18 ]. Bismuth’s non-toxic properties and good biocompatibility allow its application in molecular biology. Even though the applications of bismuth-based materials have received widespread attention, it has yet to be studied in terms of enhancing the PCR effect and its mechanism.
The mechanism of nano-PCR is still unclear because of the PCR reaction system’s complexity and materials’ characteristics. The possible mechanisms are as follows: (1) surface interactions between materials and PCR components [ 19 , 20 , 21 , 22 , 23 ]; (2) thermal conversion of materials rate [ 24 , 25 ]; (3) electrostatic interaction [ 26 , 27 , 28 ]; (4) analogous to ssDNA binding protein (SSB) [ 22 ]; (5) catalytic activity [ 29 ]. There is no doubt that these mechanisms cannot explain the impact on all the materials in PCR, and more undiscovered mechanisms need to be explored.
We used ammonium bismuth citrate and bismuth subcarbonate to optimize high GC-rich PCR. The bismuth-based compounds are cheap, readily available, and non-toxic, and bismuth subcarbonate has good medical value. They were all dissolved in a mixture of DMSO and glycerol in a certain ratio, which solves the problem that bismuth subcarbonate is insoluble in water. We found that a weak target band appeared after the mixed solvent was added alone, and the specific band within the proper concentration range was significantly enhanced after adding bismuth-based materials on the former basis. Based on the physicochemical properties of the two bismuth-based materials, we suspect their enhanced effect on PCR may be due to the first point summarized in the above mechanisms, which is surface interactions between materials and PCR components. Typical components in PCR include polymerases, primers, templates, and products. Therefore, we carried out a series of mechanism research experiments such as conventional PCR, gel electrophoresis, real-time PCR, and melting curve, and the hypothesis was confirmed. This simple, efficient, low-cost approach should find broad applications in molecular genomics.
Optimization for amplifying GNAS1 promoters
The GC content in the GNAS1 gene is as high as about 84%, which affects the optimal annealing temperature and primer specificity, making PCR amplification more

difficult [ 30 ]. Although 7-desnozo-2′ deoxyguanosine [ 31 ] is effective for amplification of GNAS1 gene promoters, a rather time-consuming "deceleration" PCR procedure based on "touchdown" PCR is still critical [ 32 , 33 ]. Here, we optimized the system with different proportions of the enzyme, DMSO and glycerol, along with eight groups of experimental conditions optimization (see Table 1 for details). At the same time, the concentration of Mg 2+ affects the activity of polymerase in the PCR system, as well as the melting temperature of the template and product, greatly influencing the reaction efficiency. So, we carried out the reaction with the concentration of Mg 2+ at 1.5 mM and 2.0 mM. As shown in Figure 1 , when treating 1.5 mM Mg 2+ , the amplification band (test 6) contained 2.50U enzyme, 3% DMSO, and 10% glycerol, which was the brightest, indicating that the target products were the highest. The target gene was amplified in all groups except for test 5, and test 1 had the least target product with an intensity of 33 ( Figure 1 b). When treating 2 mM Mg 2+ , weak target bands appeared in both test 5 and test 7 and non-specific bands also existed. So, none of the eight groups of experiments amplified the target bands with good specificity. This may be due to the high concentration of Mg 2+ , which reduces the specificity of the reaction ( Figure S1 ).
DMSO is mainly used for PCR amplification in a GC-rich system. The possible mechanism is to improve the deformation of DNA with high GC content and reduce its secondary structure, so that polymerase extends the secondary structure to improve the specificity of PCR. Conventional PCR and RT-qPCR enzyme formulations extensively use glycerol (up to 50%) to stabilize the enzyme. As a cryoprotectant, it can prolong the stability time of the reagent. In order to make the control group with only DMSO and glycerol added to the experimental group more obviously contrasted with the experimental group with the addition of materials and to maximize the enhancement of the reaction amplification by materials, we preferred to choose an experimental group that could efficiently amplify genes with high GC content while saving reagents. Thus, considering the cost of the enzyme, the practicality of the

DMSO and betaine greatly improve amplification of GC-rich constructs in de novo synthesis. — Michael A Jensen et al., 2010

Introduction Since the de novo synthesis of the suppressor transfer RNA gene was first reported three decades ago [1] , our ability to engineer and assemble synthetic gene constructs has revolutionized the field of biomedicine [2] – [5] . Yet, despite our many achievements from assembling multi-kilobase plasmids to whole genomes [6] , [7] , de novo synthesis of GC-rich fragments remains a major obstacle namely because of secondary structure formation. Sequences populated with G repeats produce complex inter and intrastrand folding due to increased hydrogen bonding with neighboring guanines at their N-7 ring positions [8] . In PCR, this phenomenon is marked by the appearance of shorter bands following gel electrophoresis. These truncated versions of the target amplicon are primarily the consequence of arrest sites (hairpins) introduced into the template causing premature termination to polymerase extension [9] . In addition, mispriming and mis-annealing between template and compliment strands due to high melting temperature ( T
m ) overlaps may contribute to incorrectly amplified gene constructs [10] . Because of these complications, GC-rich sequences are typically optimized by the researcher using web-based tools [11] – [14] that disrupt G repeats by choosing synonymous codons with lower T
m s. However, there may be instances where nucleotide conservation is essential [15] – [18] particularly for non-coding regions where secondary structure functions to activate or repress transcriptional initiation [19] . While techniques are available to manage these difficult regions during PCR amplification of plasmid and genomic DNA [20] , [21] , to our knowledge no method for de novo synthesis of GC-rich templates has been clearly defined. The closest application we found was GeneDesign [22] , which has the option to circumvent base rearrangement by adjusting the overlap between complimentary strands. While this can aid in ‘normalizing’ the overall T
m of less GC-rich sequences, synthesis of longer oligodeoxynucleotides (ODN)s is often required, and may necessitate costly purification. As a cheap and effective approach to disrupting secondary structure formation and minimizing high T
m ODN overlaps in de novo synthesis, we explored

the use of the more popular and often referenced chemical agents, Dimethyl Sulfoxide (DMSO) [23] , [24] and betaine [25] , [26] during both the assembly and PCR amplification steps in conventional gene synthesis. These isostabilizing agents facilitate strand separation of double helix DNA by altering its melting characteristics. For example, betaine, an amino acid analog with both positive and negative charges close to neutral pH, acts to equilibrate the differential T
m between AT and GC base pairings; DMSO on the other hand, acts by disrupting inter and intrastrand re-annealing. In this study, we compared the effects of these additives in the construction of two GC-rich gene fragments implicated in tumorigenesis, the Insulin-like Growth Factor 2 Receptor (IGF2R) [27] , [28] and V-raf murine sarcoma viral oncogene homolog B1(BRAF) [29] – [31] . DMSO and betaine were also chosen because of their previously reported success in PCR amplification of the IGF2R gene fragment from a vector [25] . However, for our purposes, IGF2R and BRAF were chemically synthesized and assembled in vitro by pooling overlapping, single-stranded ODNs using two conventional methods, the Polymerase Chain Assembly (PCA) [32] and the Ligase Chain Reaction (LCR) [33] . For a typical PCA reaction, assembly is done with one or two pre-PCR steps where single-stranded ODNs prime off each other, building up to the full-length product; 40 bp ODNs are designed (no gaps) with 20 bp overlap between template and compliment strands where a 3′ recess allows for polymerase binding and strand propagation. ODNs for LCR are the same as those for PCA except that each strand is 5′ phosphorylated for ligation. In this case, complimentary ODNs are denatured and annealed over several cycles for optimum strand alignment. A final round of PCR is then employed in both methods to amplify the target product using outside primers. Here we report that DMSO and betaine greatly improve de novo synthesis of IGF2R and BRAF gene

fragments generated from both PCA and LCR methods of assembly. Though we only tested two genes, incorporation of either additive could aid in the construction of most GC-rich sequences. Protocol manipulation of standard conditions is also unnecessary due to the isostabilizing properties of these additives. Even without the need for nucleotide conservation, this application saves a great deal of end-user time not having to re-design and codon optimize ODNs prior to synthesis. As such, the possibility of manually introducing sequence error is also limited; one mismatch, deletion or insertion could lead to a frame-shift or other gene lethality. Furthermore, DMSO and betaine are very inexpensive, easily obtainable and highly compatible with other biological agents, which make them ideal for any gene synthesis assay. Materials and Methods IGF2R and BRAF gene fragment designs Sequences (5′–>3′) for IGF2R (bases 32–548) and BRAF (bases 1–512) were taken from the National Center for Biotechnology Information database (ACCESSION: NM_000876 and NM_004333, respectively). They were then entered into Gene2Oligo ( http://berry.engin.umich.edu/gene2oligo/index.html ), which cut both constructs up into 40 bp fragments with 20 bp hybridizable overlap between the +/− strands [14] . Though this program has the option of calculating the optimum length of overlap given a target uniform T
m , no such parameters were defined for either construct. ODN T m values were calculated with Gene2Oligo using the Nearest Neighbor model. Synthesis of IGF2R and BRAF constructs ODN synthesis of both genes was done in-house (Stanford Genome Technology Center) with a 3900 DNA synthesizer (Applied Biosystems) using 1000 Å CPG columns (Biosearch Technologies) for a 50 nmole-scale synthesis. Cycle conditions were similar to the manufacture's recommended protocol, which included the following reagents: deblock (3% TCA/DCM) (AiC), acetonitrile, 0.02 M oxidizing solution, cap A/B, 0.1 M solutions of dA, dC, dG and dT (Proligo), and 0.25 M 5-Benzylthio-1H-t

Optimization of PCR conditions for amplification of GC-Rich EGFR promoter sequence. — Jasmina Obradovic et al., 2013

INTRODUCTION

Polymerase chain reaction (PCR) is an enzymatic in vitro method for exponential amplification of specific DNA target sequence, affordable and suitable for both basic research and various clinical applications (1). However, the method is extremely sensitive, thus, it could be a considerable challenge to optimize the conditions of the reaction in order to obtain the desired results, especially when difficult templates, such as GC-rich regions, need to be amplified. Namely, GC-rich regions, due to formation of stable and complex secondary structures within a DNA template, could block DNA polymerase during PCR reaction and lead to an ineffective amplification (2-6). PCR technique parameters that could affect its accuracy and efficacy are numerous, including concentration of DNA template, concentration of magnesium ions, PCR thermal cycling conditions, as well as addition and concentration of PCR additives (7,8). If there is a scientific or clinical need for specific and efficient amplification of GC-rich DNA template, tuning the PCR reaction could be highly demanding, yet, critically important.
Epidermal growth factor receptor (EGFR) expressed in several epithelial cancers, including lung, breast, bladder, prostate, and colorectal, plays an important role not only in carcinogenesis, but also in the cancer treatment involving tyrosine kinase inhibitors (TKIs) (9)(10)(11). A number of mutations within the EGFR coding gene has been identified, including well-known nonsynonimous deletion/insertion of exon 19 and point mutations L858R (c.2573T>G, rs121434568) and T790M (c.2369C>T, rs121434569) in exon 21 (10)(11)(12)(13). Due to their established clinical significance, EGFR is recognized as a biomarker for the development and implementation of targeted cancer therapies with EGFR-TKI, such as erlotinib or gefitinib (14,15).
Previous studies reported several single nucleotide polymorphisms (SNPs) in the transcriptional start site region of the EGFR gene promoter, including -216G>T at the Sp1 transcription factor recognition site, and -191C>A, located 4 bp upstream of one of the transcriptional start sites (16,17). Due to their location in a region essential for transcription, these polymorphisms were investigated both in vitro

and in vivo for their suggested role in modification of promoter activity and response to EGFR-TKI therapy. In 2005, Liu et al. (16), employing transient transfection in human cancer and primary cell lines, observed a significantly higher promoter activity and EGFR expression in -216T compared to -216G allele. In two prospective clinical studies of cancer patients treated with erlotinib (17) or gefitinib (12), -216G>T and -191C>A were associated with higher frequency of adverse drug reactions, such as rash or diarrhea. Nevertheless, carriers of -216T allele had an improved progression-free survival on gefitinib (12). Similar results were reported by Jung et al. (18), as a higher response rate to gefitinib or erlotinib treatment and longer progression-free survival corresponded to -216G/T compared to G/G genotype. Based on these data, it would not be surprising if the observed potential to predict efficacy and safety of the cancer treatment nominates these two polymorphisms for possible pharmacogenetic biomarkers for EGFR-TKI activity. However, EGFR promoter region has an extremely high GC content of up to 88% (19), which makes it difficult target for PCR amplification, especially in the clinical setting. The aim of the present study was to optimize the PCR conditions for amplification of the EGFR promoter sequence comprising two SNPs of interest, namely, -216G>T and -191C>A.

MATERIALS AND METHODS

Samples and DNA Isolation

DNA from formalin-fixed paraffin-embedded (FFPE) lung tumor tissue was extracted using the PureLink TM Genomic DNA Kits (Invitrogen/Life Technologies, Carlsbad, CA), according to the manufacturer's recommendations. DNA concentration was measured using Qubit R Fluorometer (Invitrogen/Life Technologies).

Bioinformatic Sequence Analysis

Melting temperature of the primers was calculated as Tm = 4 x (G + C) + 2 x (A + T) (7), and the annealing temperature was determined as Ta = 0.3 x (Tm of primer) + 0.7 x (Tm of product) - 25 (20). GC content and CpG nucleotide composition of the template DNA were determined and

presented using the bioinformatic tool "EMBOSS CpGPlot /CpGReport/Isochore" program (http://www.ebi.ac.uk/Tools/emboss/cpgplot/), with a sliding window of 100 nucleotides, shifted one nucleotide at a time.

Genotyping Method

Genotyping for -216G>T/-191C>A EGFR polymorphisms was carried out using the polymerase chain reaction -restriction fragment length polymorphism (PCRRFLP) method according to Liu et al. (12), but with modifications due to necessity of protocol optimization. In brief, using the primers described in the article, the part of the EGFR promoter region spanning both SNPs was amplified in the PCR reaction on Techne Genius Thermocycler (Techne Ltd, Cambridge, UK).
PCR reactions were run in a final volume of 25 ml. The reaction mix consisted of 1 ml genomic DNA, 0.2 mM of each primer, 0.25 mM of each of the dNTPs, and 0.625 U of TaqDNA polymerase, and it was carried out in 1x PCR buffer. Concentrations of MgCl 2 and dimethyl sulfoxide (DMSO) ranged from 0.5 to 2.5 mM, and from 1% to 5%, respectively. The initial denaturation was performed at 94 * C for 3 min; followed by 45 cycles of denaturation at 94 * C for 30 sec, gradient annealing at 61 * C/63 * C/65 * C/67 * C/69 * C for 20 sec, and extension at 72 * C for 60 sec; and with a final extension at 72 * C for 7 min. All reagents used for PCR amplification were purchased from Invitrogen.
PCR products of 197 bp were detected by gel electrophoresis on a 2% agarose gel stained with SYBR R Safe DNA Gel Stain (Invitrogen/Life Technologies) and visualized under blue light on E-Gel R Safe Imager TM Real-time Transilluminator (Invitrogen/Life Technologies). To detect -216G>T or -191C>A, PCR products were later subjected to the restriction enzymes BseRI (New England Biolabs, Ipswich, MA) or Cfr42I (Fermentas

A new approach to touch down method using betaine as co-solvent for increased specificity and intensity of GC rich gene amplification. — Daliparthy D. Pratyush et al., 2012

Introduction

Genetic analysis of diseases has become easier with advancement of molecular techniques (Saiki et al., 1988). At times it becomes difficult to study the GC rich nucleotide sequences ( Glass et al., 2007) of genes responsible for various diseases by standard PCR. GC rich regions resist denaturation and primer annealing because of their greater tendency to form secondary structures. Many researchers have carried out analyses of these long GC rich regions to obtain more specific amplicons ( Glass et al., 2007). Two-Step PCR ( Schuchard et al., 1993) and Slow-Down PCR ( Frey et al., 2008) had been shown as superior methods. Studies had also shown individual or combination of various commonly used PCR additives for e.g.: the organic chemicals formamide ( Sarkar et al., 1990), DMSO ( Chakrabarti and Schutt., 2001), BSA ( Henegariu et al., 1997), glycerol ( Lu and Negre, 1993); nonionic detergents ( Bachman et al., 1990) like Tween-20, NP40 and Triton X-100 to improve GC rich gene amplification. Tetra Methylammonium Chloride ( Chevet et al., 1995) and 7-deaza-2'- deoxyguanosine 5'-triphosphate ( McConlogue et al., 1988) were also reported to increase the yield when the above said chemicals couldn't work. In addition to these modifications several technological advancements were also done to achieve better results in terms of intensity and specificity. Hot Start is one of the well established and convenient methods that reduces nonspecific amplification during the initial stages of PCR and increases PCR amplification with higher sensitivity, specificity and yield. However, it has certain limitations: 1) long initial activation steps, 2) reduction in performance of the DNA polymerase or inadequate specificity control (Ashrafi and Paul, 2009). Gradient and TD-PCR ( Don et al., 1991) were also used by researchers as per their region of interest and requirement of study. All such studies were focused to adjust relative sensitivities of coamplified regions in comparison to control target sequence.
All these molecular advancement are not adequate enough to troubleshoot all kind of hurdles that come across in amplifying different gene segments particularly GC rich sequences. Depending upon the region of interest and hurdles, further modifications in existing tools or development of newer techniques are required. In the

present study we performed different PCR experiments of Standard, Gradient and Touchdown (TD) with the objective of amplifying GC rich segments efficiently and economicaly. Insulin Receptor Substrate 2 (IRS2) which has 74.5% GC content was taken as a target gene in the present study. This gene is of wide significance as it comes in insulin mediated downstream signalling pathway associated with somatic growth, glucose metabolism, beta cell development and its survival ( Bodhini et al., 2007).

Materials and methods

Genomic DNA was isolated from whole blood by PhenolChloroform method with minor modifications. The PCR amplifications were performed in 25 ml of reaction mixture constituting 100 ng of template DNA, 0.4 mM of each primer ( Bodhini et al., 2007), 150 mmol/L of each dNTPs and 2x tris buffer (50 mM KCl, 10 mM Tris base pH 8, 0.01% w/v gelatin) (Genei, Bangalore, India).
Step by step modifications were performed in PCR to fulfill the objective. Initially, standard PCR was performed following previously reported protocol ( Bodhini et al., 2007). The primers: forward-5' AGCTCCCCCAAGTCTCCTAA 3' and reverse-5' GGCCACACCAAAAG CCATCT 3' were purchased from Integrated DNA Technologies, Coralville, USA. The thermal profile followed was: initial denaturation at 94 degC for 4 min, cycling steps (x35) of denaturation at 94 degC for 40 s, annealing at 61 degC for 30 s, extension at 72 degC for 30 s, then final extension at 72 degC for 5 min. Subsequently, gradient PCR was performed with initial denaturation at 94 degC for 4 min followed by cycling steps (x35) of denaturation at 94 degC for 40 s, annealing (gradient temperatures from 48 degC to 63 degC) for 30 s, extension at 72 degC for 30 s followed by final extension at 72 degC for 5 min.
Before performing TD-PCR, melting temperatures (Tm) for primers were calculated using AB Veriti 96 well thermal cycler (Applied Biosystems, Sandiego, USA) that has a builtin programme to calculate Tm. Instead of applying an annealing temperature 5 degC above

to 5 degC below the primers Tm like that in a conventional touchdown PCR method we strategically altered the profile and named the modified profiles as TD-PCR(A) and (B). TD-PCR(A) was designed applying an initial annealing temperature of 61 degC with a temperature decrement of 0.2 degC following each cycle for 20 cycles. Similarly, TDPCR(B) has 56 degC initial annealing temperature with a 0.2 degC decrement after each cycle for 20 cycles. From the 21st cycle the annealing temperature of 57 degC and 52 degC in the former and the latter was kept fixed for next 15 cycles.
Amplification was done by Taq DNA polymerase (Fermentas, Maryland, USA) intially with 0.75 U to a final 3 U with 0.25 U increment in the presence of 1.5 mM to 2.5 mM MgCl 2 with increments of 0.5 mM. Four different additives e.g. glycerol, formamide, DMSO (SRL Chemicals, Mumbai, India) and betaine monohydrate (Sigma, St.Louis, USA) were tested for their efficiency to enrich the amplification of GC rich bands.
These solvents were added to the reaction mixture at various concentrations i.e., 5% for glycerol; 5% and 10% for DMSO; 1.25%, 2.5%, 5% and 10% for formamide; 0.8 M, 1.0 M and 1.5 M for betaine. Standard and TD-PCRs were performed seperately in the presence and absence of additives, whereas gradient PCR was done without additives. Further, each additive either alone or in combination with others were used in TDPCRs using different concentrations of polymerase and MgCl 2 as given above.
Amplified products were analysed by gel electrophoresis on 2% agarose (SeaKem(r) LE, Lonza, Rockland, USA) mixed with 0.5 mg/ml of ethidium bromide (Sigma, St.Louis, USA) and visualized by UV transillumination (Gel Doc XR system, Biorad, USA).

Results

All PCRs were done in duplicate and the results obtained were confirmed by repeating the experiments by other co

Polymerase chain reaction optimization for amplification of Guanine-Cytosine rich templates using buccal cell DNA. — C H W M R Chandrasekara Bhagya et al., 2013

Introduction

Polymerase chain reaction (PCR) is a widely used technique in many laboratories for diagnostic purposes and molecular biology studies. Most of the DNA templates do not require special conditions to undergo amplification, when the deoxyribonucleotide content is equally distributed among the length of the fragment to be amplified. However, lack of amplification efficiency and non-specific amplification may result in the presence of impurities and inhibitors. Furthermore, PCR amplification of Guanine-Cytosine (GC) rich regions of genomic DNA is difficult. GC rich regions produce complex inter and intra strand folding (hairpins and loops) due to increased hydrogen bonding with neighboring cytosine and guanine. These secondary structures in DNA are resistant to melting and cause Taq DNA polymerases to stall and also hampers primer annealing, resulting in incomplete or non-specific amplification. [2,3] Different methods have been developed to improve the amplification of GC rich sequences. These include addition of organic substances (additives), use of modified dNTPs and modification of thermal cycling program in PCR. The additives improve the amplification by unwinding the double stranded DNA (dsDNA) helix and thereby reducing the melting temperature. The most prominent PCR enhancing additives currently used are either betaine, small sulfoxides such as dimethyl sulfoxide (DMSO), formamide or reducing compounds such as beta-mercaptoethanol or dithiothreitol. [1, Addition of DMSO, formamide or glycerol denatures dsDNA. Betaine, an amino acid analog, stabilizes the denatured DNA. [7,8] Substituting, the guanine base CONTEXT: Amplification of Guanine-Cytosine (GC) -rich sequences becomes important in screening and diagnosis of certain genetic diseases such as diseases arising due to expansion of GC-rich trinucleotide repeat regions. However, GC-rich sequences in the genome are refractory to standard polymerase chain reaction (PCR) amplification and require a special reaction conditions and/or modified PCR cycle parameters. AIM: Optimize a cost effective PCR assay to amplify the GC-rich DNA templates. SETTINGS AND DESIGN: Fragile X mental retardation gene (FMR 1) is an ideal candidate for PCR optimization as its GC content is more than 80%. Primers designed to amplify the GC rich 5'

untranslated region of the FMR 1 gene, was selected for the optimization of amplification using DNA extracted from buccal mucosal cells. MATERIALS AND METHODS: A simple and rapid protocol was used to extract DNA from buccal cells. PCR optimization was carried out using three methods, (a) substituting a substrate analog 7-deaza-dGTP to dGTP (b) in the presence of a single PCR additive and (c) using a combination of PCR additives. All PCR amplifications were carried out using a low-cost thermostable polymerase. RESULTS: Optimum PCR conditions were achieved when a combination of 1M betaine and 5% dimethyl sulfoxide (DMSO) was used. CONCLUSIONS: It was possible to amplify the GC rich region of FMR 1 gene with reproducibility in the presence of betaine and DMSO as additives without the use of commercially available kits for DNA extraction and the expensive thermostable polymerases.
Key words: Enhancers, fragile X syndrome, guaninecytosine-rich sequences, polymerase chain reaction additive, polymerase chain reaction Bhagya, et al.: Amplification of guanine-cytosine rich templates analog, 7-deaza-dGTP for dGTP, in a ratio of 3:1 can reduce the number of hydrogen bonds that are formed between guanine and cytosine in dsDNA as well as single stranded DNA (ssDNA) because it lacks nitrogen at the seventh position of the purine ring. Therefore, addition of 7-deaza-dGTP prevents formation of stable intramolecular G * C Hoogsteen base pairing without disrupting the normal Watson-Crick base pairing. [1,9,10] Alkaline denaturation of template prior to PCR is also employed to facilitate the PCR. The above facts are relevant in genetic studies as 3% of the human genome is highly GC rich and 28% of the genes are located within the GC rich regions. Several genetic diseases arise due to the expansion of GC rich trinucleotide repeat sequences. One such example is the fragile X mental retardation gene (FMR 1), which contains a polymorphic CGG repeat of 5-55 copies in the 5' region of the gene. Fragile X Syndrome occurs due to expansion of these CGG trinucleotide repeats

up to more than 200 copies. The Huntingtin gene associated with Huntington disease contains a polymorphic CAG trinuleotide repeats with varying the repeat number from 11 to 34 CAG. Myotonic dystrophy protein kinase gene is another GC rich gene which contains CTG repeats and involve in the myotonic dystrophy. Genetic tests for screening and disease diagnosis associated with expansion of trinucleotide repeats are based on identifying these repeat sequences.
PCR amplification has been proposed as a rapid method for amplification of trinucleotide repeat regions compared to Southern hybridization. In this article, we report the results of three methods that were used to optimize the PCR amplification of the GC rich 5' region of the FMR 1 gene using DNA extracted from buccal cells. The aim was to develop a low-cost PCR assay for amplification of GC rich regions which can be used to screen diseases associated with GC rich sequences.

Materials and Methods

All chemicals used in the study were molecular grade and unless otherwise specified, were purchased from of the FMR1 gene 5' region was selected for PCR amplification using primer c and f as stated in Fu et al. (1991). The following three procedures (a), (b) and (c) were carried out to amplify the GC rich template.
DNA extracted from a single individual was used in all optimization reactions and hot start PCR was performed. Ten microliters from all PCR products were electrophoresed on 2% agarose gel containing 10 mg/ml of ethidium bromide for 30 min at 75 V and bands were visualized under ultraviolet light from Uvi pro silver gel documentation system (UV tech).
Using substrate analogue, 7-deaza-dGTP 1. Initially the PCR was carried out as described by Fu et al. (1991) by partially substituting 7-deaza-dGTP for dGTP at a ratio of 3: Thermo cycle condition was: Initial denaturation at 95degC for 10 min followed by 25 cycles of denaturation at 95degC for 1.5 min, annealing at 65degC for 1 min and extension at 72degC for 2 min. 2. The annealing temperature was varied from 58degC
to 65degC by a 1degC increment keeping the reaction conditions the same as in (1) (1)

Universal Method Facilitating the Amplification of Extremely GC-Rich DNA Fragments from Genomic DNA — Maochen Wei et al., 2010

EXPERIMENTAL SECTION

Design of Primers. Primer design was performed by commercial software (Primer Premier 5.0, PREMIER Biosoft International, USA). All primers used in this study were synthesized by Invitrogen Bio. Inc. (Shanghai, China).
Preparation of Templates. Human genomic DNA was prepared from healthy human blood using a QIAamp DNA Blood Mini Kit (Qiagen, Germany). Hamster genomic DNA was prepared from Cricetulus barabensis ovary cells using a Mammalian Cell Extraction kit (Biovision, USA). Oryza sativa Japonica genomic DNA was extracted according to the method described previously. 17 PCR Reactions. PCR reactions were set up in a total volume of 25 uL containing 2.5 uL of 10x DNA polymerase buffer, 2.0 mM MgCl 2 , 0.2 mM of each dNTP, 2.0 uM of each primer, and 100 ng of genomic DNA; 1 U Taq polymerase such as LA Taq polymerase and Exact polymerase (TaKaRa Bio Inc., Japan) or thermo-stable polymerases including DeepVent polymerase, Pfu polymerase, and Vent (exo-) polymerase (New England Biolabs, Inc., USA) were added. 7-Deaza-dGTP (150 uM, New England Biolabs, Inc., USA) and 50 uM dGTP were used to replace 0.2 M dGTP in "Slowdown PCR".
GNAS1 was chosen to examine the effects of different additives on PCR amplifications. Additives were added alone at the following concentrations: 0.5-2.0 M betaine (Sigma, USA), 1-10% DMSO (Sigma, USA), and 5-20% glycerol (Sigma, USA). Different mixtures of additives including A 1 (5% DMSO, 5% glycerol and 1.4 M betaine), A 2 (150 uM 7-deaza-dGTP and 50 uM dGTP), and A 3 (5% DMSO, 50 uM 7-deaza-dGTP and 1.3 M betaine) were combined with procedures of "SAFE (satisfactory, adaptable, fast, efficient) PCR",

"Slowdown PCR", and "Two-Step PCR", respectively.
Cycling Procedures. All PCR amplifications were performed with an Eppendorf Personal Master Cycler except for "Slowdown PCR', which was conducted on a Bio-Rad Mycycler Thermal Cycler.
"Conventional PCR" was performed with an initial step of 95 degC for 5 min, then 40 cycles with 30 s denaturation at 95 degC, 30 s annealing with fixed temperatures at optimal annealing temperature T a calculated by Primer Premier 5.0 software, followed by primer extension of 40 s at 72 degC, and concluded with a final extension at 72 degC for 5 min.
"Two-Step PCR" was conducted through a denaturation step of 3 min at 94 degC and 35 cycles consisting of 10 s at 94 degC and 3 min at 68 degC, completed with a final extension at 72 degC for 5 min.
"Slowdown PCR" was carried out with the following cycling conditions: the templates were denaturized at 95 degC for 5 min, and then, 48 cycles composed of 30 s at 95 degC, 30 s annealing with a stepwise reduction of annealing temperature from 70 to 53 degC decreased by 1 degC every third cycle, 40 s at 72 degC (ramp rate: 2.5 degC s -1 ; cooling rate: 1.5 degC s -1 ), were run. After 48 cycles, 15 additional cycles with a denaturation step at 95 degC for 30 s, annealing step at 58 degC for 30 s, and elongation step at 72 degC for 40 s were conducted and completed with a final extension at 72 degC for 5 min.
"SAFE PCR" was performed as described in Figure 1. All PCR products were analyzed with 1.5% agarose-gel electrophoresis and stained with GoldviewTM (SBS Bio Inc., Beijing, China).
DNA Sequencing and Analysis. A single strip of PCR products was purified by an AxyPrepTM DNA gel extraction kit (Axygene Biotech Ltd., USA) and ligated to a pMD18T or pMD18T simple vector using a T-vector kit (TaKaRa Bio Inc., Japan). The constructs were transformed to E. coli Top10 cells. Endonuclease digestion was performed to select the

positive clones. The positive colonies were sequenced by Invitrogen (Shanghai, China) with ABI Genetic Analyzer 3730 (Applied Biosystems).
DNA alignments were conducted with BLASTnr from NCBI online service (http://blast.ncbi.nlm.nih.gov/Blast.cgi), and the base composition plot of GC content was conducted by Omiga 2.0 software (Oxford Molecular Ltd., USA).

RESULTS AND DISCUSSION

Optimizations of Procedure and Additives. GNAS1 is an important genetic marker for various diseases, such as pseudohypoparathyroidism, hypertension, bladder cancer, clear cell renal cell carcinoma, and pituitary tumor. 18,19 Because the mutations of GNAS1 cause genetic diseases and cancers, 18 the analysis of single nucleotide polymorphisms of this gene has been a valuable tool for pharmacogenetics studies. However, mutational scanning of GNAS1 was only limited to short sequences. 20 Considering that an 826 bp fragment of GNAS1 contains a GC content of 83% with internal partial sequences greater than 90% (Figure 2a), it was chosen as a subject to examine currently available PCR procedures in conjunction with different additives in the present study. Related primers used in this work are listed in Table 1. As shown in Figure 2b lanes 5, 6, and 8, all PCR procedures with different additives failed to amplify the GNAS1 gene except for the combination of "Two-Step PCR" and a mixture of DMSO, betaine, and 7-deaza-dGTP ( Figure 2b lane 9); the causes for failures are unclear at present. However, this method resulted in band compression and random mutagenesis after sequencing multiple times (see Figure S1 in Supporting Information), which is possibly due to the sequencing errors in the presence of 7-deazadGTP and incorporation of 7-deaza-dGTP. 21 To avoid such low fidelity, investigation of different additives was then undertaken. Since glycerol is known to lower melting temperature of DNA and its special polyhydroxy structure can reduce the inhibitory effect of DMSO on the polymerase, 22 we examined the possibility of substituting 7-deaza-dGTP with glycerol. After evaluating different ratios of the additives, a combination consisting of 5% DMSO,

Bovine serum albumin further enhances the effects of organic solvents on increased yield of polymerase chain reaction of GC-rich templates — Eric M Farell et al., 2012

Background Ever since the introduction of the Polymerase Chain Reaction [ 1 ], it has been one of the most often used tools in molecular biology, and has played a role in many of the major advances in Biology including cloning [ 2 ], mutagenesis [ 3 ], even with small amounts of DNA target [ 4 ]. This technique is not without its limitations though, as some DNA templates have proved difficult to amplify. The most common reason for troublesome amplification lies in target DNA sequences that have high GC content (GC content >60%) [ 5 ]. Many studies have been undertaken to identify experimental modifications that would alleviate or eliminate this problem altogether, with most studies focusing mainly on primer design [ 5 – 7 ], altering the cycling parameters [ 8 , 9 ], and the use of PCR additives [ 10 – 17 ]. PCR additives most often employed are organic co-solvents such as DMSO and formamide [ 12 , 13 , 15 , 16 ]. DMSO has been found to significantly increase the yield of a PCR reaction on GC-rich DNA templates, by preventing the formation of secondary structures [ 5 ]. The effects of formamide are less clear and still debated, with some studies indicating that formamide greatly increases specificity of amplification of GC-rich DNA templates and others failing to detect any effect [ 14 , 16 ]. Formamide also appears to be effective only within a narrow concentration range [ 10 ] which may be related to the fact that formamide is postulated to bind to the grooves in DNA, thus destabilizing the double helix and perhaps improving initial melting [ 10 ]. Bovine serum albumin (BSA) has been applied to many laboratory molecular techniques, including restriction enzyme digestions of DNA to increase the thermal stability and half-life of the restriction enzymes in the reactions [ 18 ]. For this reason, its effects have also been investigated in PCR and several studies have demonstrated that BSA have a beneficial effect on the yield of PCR (and qPCR) amplification of ancient DNA or of DNA found in extracts from feces, freshwater, or marine water [ 19 , 20 ]. The beneficial effects of BSA were observed in the absence of any other additive. Since, most of the PCR inhibitors in the samples analyzed in these experiments were also substances that BSA can bind to, the beneficial effects of BSA were proposed to prevent these inhibitors from interacting with DNA (Taq) polymerase [ 19 ]. When used in PCR amplification from genomic DNA that is free of any PCR inhibitors, B

SA has not been shown to have a significant effect on specificity or amplification yield [ 13 ]. In fact, the effect of BSA on PCR has not been systematically analyzed. Here, we use BSA in conjunction with organic solvents, DMSO or formamide, to amplify NA templates of high GC content. Our results demonstrate that when used with organic solvents, BSA acts as a powerful co-enhancer of PCR amplification of these DNA templates. We also provide evidence that supports the notion that one of the reasons that its effects have gone unnoticed is due to the fact that BSA is sensitive to high temperatures of PCR, and rapidly loses its enhancing abilities. Adding BSA to PCR reactions in presence of organic solvents also allows high PCR yields of GC-rich DNA of various sizes to be obtained while reducing the concentration of solvent used. Using the genomic DNA of the alphaproteobacterium Azospirillum brasilense Sp7 [ 20 ] which has a GC content above 65% [ 21 ], we have tested various cycling parameters and combination of additives to amplify DNA fragments ranging from 392 to 7,103 base pairs, (with each having a GC content of 66% or greater). For this study, the DNA sequences corresponding to regions of interest were retrieved from the draft genome sequence of Azospirillum brasilense ( http://genome.ornl.gov/microbial/abra/19sep08/ ) and from sequences available in the NCBI GenBank database. The DNA templates were a 392 base pair fragment with a GC content of 66% (che1P) (NCBI GI 17864024), a 798 base pair fragment with a GC content of 68% (tlp5) (contig 115, or2365), a 1,641 base pair fragment with a GC content of 73% (cheA4) (contig 120, or3019), a 2,638 base pair fragment with a GC content of 66% (tlp2) (contig 213, or4271), a 3,389 base pair fragment with a GC content of 68% (cheA1) (NCBIGI17864025), and a 7,103 base pair fragment with a GC content of 68% (cheOp1) (NCBI GI 17864024). We also applied this protocol in “Touchdown” PCR, as well as in an

overlap extension PCR and in combination with a widely used commercialized site-directed mutagenesis kit (Stratagene Quickchange Site Directed Mutagenesis Kit, Stratagene) with primers designed to introduce a single amino acid change. Our results highlight a strategy and experimental conditions for using BSA as a co-enhancer that significantly increases PCR yields when used with solvent additives in various PCR applications.
Findings Of the DNA fragments that we initially attempted to amplify, only tlp2, che1P, and cheA1 (Table 1 ) produced a PCR amplification product without the use of solvent additives, when genomic DNA of A. brasilense was used a s a template (Figure 1 ). The effects of DMSO at 1.25%, 2.5%, 5.0%, 7.5%, and 10%, (w/vol) as well as formamide at similar concentrations as additives in PCR were first tested (Figure 1 ). A set of PCR was also run with BSA at 1–10 μg/μl (data not shown). Consistent with data from the literature [ 13 ], while both DMSO or formamide addition in PCR promoted increased yield of amplification of DNA fragments of 2–3 kb, the enhancing effect of DMSO was greater than that of formamide (Figure 1 ). Under these conditions, we also observed that increasing the concentration of DMSO could also lead to decrease in PCR specificity (Figure 2 ). On the other hand, the effect of formamide in promoting increased PCR yield decreased for DNA fragments larger than about 2.5 kb (Figure 1 ). There was no significant effect of adding BSA alone as a PCR additive, under these conditions, including no detrimental effect (Data not shown). The enhancing effects of BSA on PCR yields were detected when used in combination with DMSO or formamide, over a broad range of DNA fragment sizes (Figure 2 ). Furthermore, BSA addition broadened the range of concentrations for which the organic solvent could be added, even for DNA templates of larger sizes (Figure 2 ). The consensus of the current literature on formamide indicates that it is most effective as a PCR additive when used at concentrations ranging from 0 to 5%, with effectiveness dropping off completely at 10% [ 10 ]. Our results indicate that in presence of BSA, formamide is effective at least up to concentrations of 10% and with DNA templates up to 2.5

PCR-amplification of GC-rich regions: 'slowdown PCR' — Ulrich H Frey et al., 2008

INTRODUCTION

Since its invention in 1988, PCR has become the most widely used technique in many laboratories for the amplification of DNA for either diagnostic or molecular biology purposes, including pharmacogenetics 1,2 . Despite the fact that a large number of DNA sequences can be easily analyzed using PCR-based methods, the occurrence of nonspecific bands often results in time-consuming PCR setup procedures 3 . Moreover, some GC-rich sequences are refractory to amplification due to the formation of secondary intramolecular structures 4,5 . Many important regulatory domains that are currently a focus of scientific interest, including promoters, enhancers, and other control elements, harbor GC-rich ciselements 6 . Therefore, an easy-to-use PCR technique that allows the amplification of GC-rich elements could provide a time-saving technique in a single protocol. Here, we report a novel method termed 'slowdown PCR' for generating specific PCR products even for extremely GC-rich templates that are usually present in regulatory regions of genes . Using this method, templates with GC content of up to 84% can successfully be amplified. This method is therefore especially suitable to facilitate cloning of promoter fragments. Moreover, this technique is also suitable for routine diagnostic purposes.

PCR amplification of GC-rich templates

The human genome has a size of 3.4 A 10 9 base pairs (bp). However, only a small fraction of this sequence is known to have any function. It is estimated that there are B30,000 genes in the human genome from which 28% are located in the so-called GC-rich regions (GC content 460%) 13 . Moreover, gene-regulatory elements, including promoters, enhancers and other control elements, consist of GC-rich elements 6 . Cloning and sequencing of these regions is essential in molecular research and starts with the amplification of the designated template through PCR. The critical step during PCR cycling to ensure specificity and efficiency of the reaction is using the optimal annealing temperature (T a ) at which primers bind to their specific template. The optimal annealing temperature is determined by both primer and product melting temperatures (T m ) (ref. 14). DNA regions with high GC content as well as primers with high T m are, however, susceptible to form secondary structures. Therefore, it is critical to find the exact primer-template annealing temperature without formation of secondary structures. In the case of GC-rich

sequences, the single-stranded template may form intramolecular stem loops during the initial cycles of amplification, resulting in hairpin structures that are not amplified in subsequent cycles by the Taq polymerase. This promotes amplification of shortened PCR products lacking the stem loop sequence. Moreover, longer nonspecific PCR products may be produced by mispriming when primers anneal to sequences with lower GC contents 4 .
Different methods have been developed to amplify GC-rich sequences . Addition of organic molecules such as formamide 18 , DMSO 19 , glycerol 20 , betaine 21 or 7-deaza-2C/-deoxyguanosine (dc 7 GTP) (ref. 22) has been shown to improve the amplification of GC-rich DNA sequences. However, in the case of GC-rich targets, the performance of these chemicals is unpredictable and use of commercially available kits often fails to yield any product without further PCR modification or optimization. Alternatively, the reduction of primer T m (ref. 23), unwinding of the double-stranded DNA helix 24 or precluding alternative base pairing 25 are reported to improve amplification especially of GC-rich regions of the DNA template.

Alternative PCR-based techniques

Methods that rely on the alteration of PCR cycling conditions can alternatively be used for PCR optimization. These are based on the usage of different annealing temperatures as in the cases of 'touchdown' 26 or 'stepdown' 27 PCR methods, for example. These methods rely on the usage of a range of different annealing temperatures, which are sequentially run through the course of a PCR cycle. Higher annealing temperatures compared with the expected primer T a during the initial PCR cycles result in increased PCR product specificity, as spurious primer-template interactions are sufficiently less stable than the specific ones. As a result, these methods can achieve a balance between high-efficiency PCR at low annealing temperature, which may amplify nonspecific products, and using an annealing temperature too high to achieve specificity that results in a poor yield of the desired PCR product 26,27 . Figure 1 shows a comparison of different cycling techniques. Standard PCR is performed with a fixed annealing temperature and is suitable for templates with low-to-medium GC content (o60%). This method is fast and applicable for routine PCR experiments. Touchdown PCR was invented by Don et al. 26 . This method uses a decrease in an

nealing temperature of 1 1C every second cycle from T a +5 1C to T a A5 1C followed by ten additional cycles with a fixed annealing temperature at T a A5 1C and was developed to circumvent spurious primer binding.

Slowdown PCR

Here, we report a protocol for generating specific PCR products even for extremely GC-rich templates usually present in regulatory regions of genes 7 . This protocol is also useful for different routine PCRs in which different annealing temperatures are used. This method is characterized by the use of slow ramping rates (see below) and an increased number of cycles at the same annealing temperature (see below for cycling conditions). It is used with a reduced ramp rate of 2.5 1C s A1 and especially a slow cooling rate to reach the annealing temperature of 1.5 1C s A1 . Both conditions are critical for the success of the method. Moreover, addition of dc 7 GTP to the PCR mixture is a basic principle of the slowdownPCR method (see below). The 'slowdown' PCR technique described here optimizes primer annealing by decreasing the annealing temperature every third cycle and using slow cooling rates. This may result in an increased likelihood of specific primer binding to the template, by enabling annealing at the exact T a without the formation of interfering secondary structures.

Proof of principle

To confirm the usefulness of our protocol, we chose exon1 of the BRAF gene, which had escaped amplification and sequencing despite the use of five different primer pairs 28 to demonstrate a pathway for successful amplification for GC-rich targets. Primer design (see below for further details of primer design) was undertaken using Primer Premier software (Table 1); dc 7 GTP was added, and 'slowdown' cycling conditions were used (see below) as described above. We were able to generate a single specific band of the correct size whereas standard or 'touchdown' PCR failed. Sequencing confirmed this amplicon to be exon1 of the BRAF gene 7 . Using the 'slowdown' technique and dc 7 GTP, we also amplified the complete GNAS1 and GNAQ promoters, which are characterized by extremely GC-rich regions with a GC content of up to 86% (refs. 8,9), and successfully sequenced the whole GNAS1 promoter with GC contents of up to 86.3% and

A primer design strategy for PCR amplification of GC-rich DNA sequences. — Li-Yan Li et al., 2011

Introduction

Polymerase chain reaction (PCR), widely applied in many research fields, is one of the routine molecular biology techniques. However, PCR amplifications of GC-rich sequences involve much greater difficulties than those of non-GC-rich ones [1,2]. Although only about 3% of the human DNA sequences are GC-rich, the majority of the important regulatory domains including promoters, enhancers, and control elements consist of GC-rich sequences , and most housekeeping genes, tumor suppressor genes, and approximately 40% of tissue-specific genes contain GC-rich sequences in their promoter region . Obviously, ineffective PCR amplifications of these GC-rich DAN sequences hamper the progress of the study into these gene sequences.
The conventional practice for cracking this hard nut of ineffective PCR amplification is adding certain organic additives such as betaine, dimethylsulfoxide, formamide, polyethylene glycerol, non-ionic detergents, 7-deaza-dGTP, dUTP and their combinations to the reaction mixture, or jointly using such highly effective DNA polymerase as AmpliTaq(tm), Taq Gold(tm), and KOD Hot-Start polymerase , Optimase DNA polymerase, Platinum (r) Taq DNA Polymerase High-Fidelity, etc. , during the course of PCR amplification. In addition, techniques such as template denaturation with NaOH, hot start PCR, stepdown PCR, and slowdown PCR can also improve the PCR amplification of GC-rich sequences ; other factors including adjusting magnesium concentration, buffer pH, denaturing and annealing time and/or temperature, and PCR cycling numbers are sometimes also to be taken into account.
It is widely believed that the major cause of ineffective amplifications of GC-rich templates is the formation of secondary structures such as loops or hairpins brought about by GC-rich DNA templates and/or primers' self-complementary or other conformational features .
Primer is a crucial factor for successful PCR amplifications. Precise primer designing and analyzing, especially that of their secondary structures such as self-dimers, hairpins, and cross-dimers , before PCR amplifications, are necessary. In this study, an in-depth study was made into fifteen pairs of primers recorded in the related literature for amplifications of GC-rich templates. It was found that Clinical Biochemistry 44 (2011)

Contents lists available at ScienceDirect

Clinical Biochemistry j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / c l i n b i o c h e m

all the primers studied shared some defects such as over-low melting temperature (T m ), over-high level of T m difference of primer sets (DT m ), or mismatching between the primer and multiple loci of the templates. All these defects with the primer will lead to either annealing failure or annealing of multiple loci of the DNA templates, which would further give rise to the ineffective amplifications or non-specific ones. Given that these primer defects are common reasons for invalid PCR amplifications of GC-rich sequences, it just shows that the solution to this problem lies in nothing but the effective primer designing, especially for amplifications of GC-rich DNA templates. In this study, a specific primer designing strategy featuring high T m and low DT m was established. According to this strategy, fifteen pairs of primers with specific parameters for amplifications of GC-rich DNA sequences and twenty-six more pairs were designed for testing the applicability of this strategy in amplifications of non-GC-rich sequences.

Materials and methods

DNA templates

A total of fifteen GC-rich and twenty-six non-GC-rich DNA target sequences were employed in this study. The fifteen GC-rich DNA sequences are from eight genes: HBA2 (NC_000016.9), FMR1 (NC_000023.10), APOE (NC_000019.9), HRES1 (NC_000001.9), CSTB (NC_000021.8), INSR (NC_000019.9), AR (NC_000023.10), and GATA4 (NC_000008.10), with the GC content of these primers ranging from 66.0% to 84.0%; the twenty-six non-GC-rich DNA target sequences are from twenty-six exons of F8 gene located in Xq28, whose GC content range from 35.2% to 53.5%. (All sequences of these genes were obtained from http://www.ncbi.nlm.nih.gov/nucleotide/).

Genomic DNA is isolated from human white blood cells using the conventional phenol-chloroform method.

Primer designing and optimizing

The fifteen pairs of primers for amplifications of GC-rich sequences were designed manually. In order for the primers to have the highest possible T m (N79.7 degC) and the smallest possible DT m (1.0 degC), several nucleotides were added to or removed from the 5' and/or 3' ends of each primer based on DNA targets, under the precondition that the primers were complementary to the DNA sequence templates. The GC contents of PCR products and the primer parameters including T m , DT m , the maximum DG free energy of self-dimer, cross-dimer, and hairpin were worked out by means of the software Oligo 6.64 (Molecular Biology Insights, Inc., CO).
The fifteen pairs of primers in this study were shortened by reducing two bases from primer 5' ends as control experiments.
In addition, twenty-six other pairs of primers with higher T m and lower DT m of primer sets were designed according to the strategy mentioned above, for testing the applicability of the strategy in the amplifications of non-GC-rich sequences. All the primers in this study were synthesized by Invitrogen (Guangzhou, PR China). The parameters of the two groups of primers designed for this study and the fifteen pairs recorded in the related reference literature were detailed in Tables 1-3, respectively.

PCR system and amplification conditions

All PCRs were carried out under the following conditions: 50-200 ng of human genomic DNA, 0.2 mM of each primer, 50 mM of each dNTPs, 2.0 U of Taq DNA polymerase enzyme, and 5 mL of 10x buffer supplemented with 100 mM Tris-HCl (pH 8.3), 500 mM KCl, and 15 mM MgCl 2 (Takara, Dalian, PR China). The final volume was adjusted to 50 mL with water.
The reactions were performed in a Gene Amp PCR system 9700 (PE Applied Biosystems). The amplifications of the GC-rich DNA Table 1 Parameters of fifteen pairs of primers for GC-rich DNA amplifications in this study.

Gene

Primer Max DG free energy (k